Sequence ID | >SRA1038018 |
Genome ID | SRR035090.234247 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001811) |
Species | |
Start position on genome | 382 |
End posion on genome | 457 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
aagtgtcgat |
tRNA gene sequence |
GTGCCCGTAGCTCAATGGATAGAGCATCAGCCTTCTAAGCTGAGGGTTACTGGTTCGAGT |
Downstream region at tRNA end position |
atggaagtcc |
Secondary structure (Cloverleaf model) | >SRA1038018 Arg TCT t ACCA atggaagtcc G - C T - A G - C C - G C - G C - G G - C T G T T G A C C A T A A A | | | | | G G C T C G A C T G G C G | | | | T T A G A G C T A A GGGTT T - A C - G A - T G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |