Sequence ID | >SRA1038120 |
Genome ID | SRR035090.249130 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001811) |
Species | |
Start position on genome | 100 |
End posion on genome | 182 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
tcattccact |
tRNA gene sequence |
GCGAGAGTGGTGAAATTGGTATACACGCTAGTCTTAGGAACTAGTGCCGTGAGGCGTGAG |
Downstream region at tRNA end position |
ccccaggaaa |
Secondary structure (Cloverleaf model) | >SRA1038120 Leu TAG t ACtc ccccaggaaa G - C C - G G - C A - T G - C A - T G - C T T T T T C C C A T A A G + | | | | G T A G T G G A G G G C G | | | T T G A C A C T A T G TGCCGTGAGGCGT C - G T - A A - T G - C T - A C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |