Sequence ID | >SRA1038191 |
Genome ID | SRR035090.261603 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001811) |
Species | |
Start position on genome | 268 |
End posion on genome | 183 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
atttcatatt |
tRNA gene sequence |
GTCGGGATCGCCAAGTCTGGTCAACGGCGCAGGACTTAAGATCCTGTTACACTAGTATTC |
Downstream region at tRNA end position |
atcgtttcac |
Secondary structure (Cloverleaf model) | >SRA1038191 Leu TAA t ACtt atcgtttcac G - C T - A C - G G - C G - C G - C A - T T A T T A C C C A C T G A C + | | | | A T A C C G G T G G G C G | | | T T G C G G C T C A A G TTACACTAGTATTC C - G A - T G - C G - C A - T C A T G T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |