Sequence ID | >SRA1038288 |
Genome ID | SRR035090.280359 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001811) |
Species | |
Start position on genome | 246 |
End posion on genome | 171 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
nnnctttaat |
tRNA gene sequence |
GGAGCTGTAGCTCAGTCTGGTTAGAGCGCCTGCCTGTCACGCAGGAGGTCGCGGGTTCGA |
Downstream region at tRNA end position |
aaaaaaggtc |
Secondary structure (Cloverleaf model) | >SRA1038288 Asp GTC t GCag aaaaaaggtc G - C G - C A - T G - C C - G T - A G - C C G T T G C C C A C T G A A + | | | | G T C T C G G C G G G C G | | | | T T G G A G C T T A G AGGTC C - G C - G T - A G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |