Sequence ID | >SRA1038353 |
Genome ID | SRR035090.290636 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001811) |
Species | |
Start position on genome | 355 |
End posion on genome | 428 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
ggacaatcgg |
tRNA gene sequence |
GCCCTTGTAGCTCAGTGGATAGAGCAGTAGTTTCCGGAACTAAAGGTCGGCAGTTCGAAT |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >SRA1038353 Arg CCG g ACnn nnnnnnnnnn G - C C - G C - G C - G T - A T T G - C T A T C C G T C A T G A A | | | | | G G C T C G G G C A G C G | | | | T T A G A G C T A A AGGTC G A T - A A - T G - C T - A T A T G C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |