| Sequence ID | >SRA1038470 |
| Genome ID | SRR035090.311366 |
| Phylum/Class | 454 Sequencing (SRP001811) |
| Species | |
| Start position on genome | 245 |
| End posion on genome | 326 |
| Amino Acid | Leu |
| Anticodon | TAG |
| Upstream region at tRNA start position |
cgatttttac |
| tRNA gene sequence |
GGGCGGATGGCGGAATTGGTAGACGCGCTAGTCTTAGGAACTAGTGGGGCAACTCATGGA |
| Downstream region at tRNA end position |
aataaaaatt |
| Secondary structure (Cloverleaf model) | >SRA1038470 Leu TAG
c Attt aataaaaatt
G - C
G - C
G - C
C - G
G - C
G - C
A - T T G
T T C T C C A
T A A G + | | | | A
T G G C G G G A G G C
G | | | T T
G A C G C
T A G G TGGGGCAACTCAT
C - G
T - A
A - T
G - C
T - A
C A
T G
T A G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |