Sequence ID | >SRA1038478 |
Genome ID | SRR035090.313153 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001811) |
Species | |
Start position on genome | 311 |
End posion on genome | 385 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
tagttaatac |
tRNA gene sequence |
GCTCCTGTGGTGTAGTCTGGCCAATCATCTTAGATTTTCGATCTAAGGACCCGGGTTCGA |
Downstream region at tRNA end position |
tatttccaga |
Secondary structure (Cloverleaf model) | >SRA1038478 Glu TTC c Attt tatttccaga G - C C - G T - A C - G C - G T + G G - C T A T G G C C C A C T G A G | | | | | G T T G T G C C G G G C G | | + T T G T C A T C C A A C GGAC T - A T - A A - T G - C A - T T A T G T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |