| Sequence ID | >SRA1038733 |
| Genome ID | SRR035090.356411 |
| Phylum/Class | 454 Sequencing (SRP001811) |
| Species | |
| Start position on genome | 201 |
| End posion on genome | 274 |
| Amino Acid | Ala |
| Anticodon | CGC |
| Upstream region at tRNA start position |
tggatgcccc |
| tRNA gene sequence |
GGGGCTTTAGCTCAGTTGGTAGAGCGTCTCGTTCGCAATGAGAAGGTCAGGGGTTCGACT |
| Downstream region at tRNA end position |
ccgctaattc |
| Secondary structure (Cloverleaf model) | >SRA1038733 Ala CGC
c ACag ccgctaattc
G - C
G - C
G + T
G - C
C - G
T - A
T - A T C
T T C C C C A
T G A A | | | | | G
T C T C G A G G G G C
G | | | | T T
G G A G C
T A G AGGTC
T - A
C - G
T - A
C - G
G + T
T A
T A
C G C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |