Sequence ID | >SRA1039144 |
Genome ID | SRR035090.431571 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001811) |
Species | |
Start position on genome | 240 |
End posion on genome | 167 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
gctcgattag |
tRNA gene sequence |
GCGGGAGTAACTCAGTTGGTAGAGTCACAGCCTTCCAAGCTGTTGGTCGCGAGTTCGAAT |
Downstream region at tRNA end position |
gatttatgaa |
Secondary structure (Cloverleaf model) | >SRA1039144 Gly TCC g TCag gatttatgaa G - C C - G G - C G - C G - C A - T G - C T A T T G C T C A T G A A + | | | | G T C T C A G C G A G C G | | | | T T G G A G T T A C TGGTC A - T C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |