| Sequence ID | >SRA1039280 |
| Genome ID | SRR035090.457197 |
| Phylum/Class | 454 Sequencing (SRP001811) |
| Species | |
| Start position on genome | 102 |
| End posion on genome | 174 |
| Amino Acid | Glu |
| Anticodon | TTC |
| Upstream region at tRNA start position |
catgtttttt |
| tRNA gene sequence |
GGCCCCATCGACTAGCGGTTAGGTCACCACCCTTTCAAGGTGGCGGGACGGGTTCGAATC |
| Downstream region at tRNA end position |
ttcaaagctc |
| Secondary structure (Cloverleaf model) | >SRA1039280 Glu TTC
t ACac ttcaaagctc
G - C
G + T
C - G
C - G
C - G
C - G
A - T T A
T T G C C C A
C G A C | | | | | G
G T C A G A C G G G C
G + | | | T T
T G G T C
T A A CGGG
C - G
C - G
A - T
C - G
C - G
C A
T A
T T C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |