| Sequence ID | >SRA1039652 |
| Genome ID | SRR035090.537238 |
| Phylum/Class | 454 Sequencing (SRP001811) |
| Species | |
| Start position on genome | 323 |
| End posion on genome | 250 |
| Amino Acid | Arg |
| Anticodon | CCG |
| Upstream region at tRNA start position |
ggacaatcgg |
| tRNA gene sequence |
GCCCTTGTAGCTCAGTGGATAGAGCAGTAGTTTCCGGAACTAAAGGTCGGCAGTTCGAAT |
| Downstream region at tRNA end position |
ggaataaggg |
| Secondary structure (Cloverleaf model) | >SRA1039652 Arg CCG
g ACag ggaataaggg
G - C
C - G
C - G
C - G
T - A
T T
G - C T A
T C C G T C A
T G A A | | | | | G
G C T C G G G C A G C
G | | | | T T
A G A G C
T A A AGGTC
G A
T - A
A - T
G - C
T - A
T A
T G
C C G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |