Sequence ID | >SRA1039780 |
Genome ID | SRR035090.566882 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001811) |
Species | |
Start position on genome | 173 |
End posion on genome | 98 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
ggtttctatg |
tRNA gene sequence |
GTGATTGTAGCTCAGTTGGTTAGAGCGCCAGGTTGTGGCCCTGGAGGTCGGGGGTTCGAG |
Downstream region at tRNA end position |
gttttttggc |
Secondary structure (Cloverleaf model) | >SRA1039780 His GTG g CCAt gttttttggc G - C T - A G - C A - T T T T - A G - C T G T T C C C C A T G A A + | | | | G T C T C G G G G G G C G | | | | T T G G A G C T T A G AGGTC C - G C - G A - T G - C G - C T C T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |