Sequence ID | >SRA1039873 |
Genome ID | SRR035090.588790 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001811) |
Species | |
Start position on genome | 309 |
End posion on genome | 236 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
ccataagtat |
tRNA gene sequence |
CGGGGTGTGGCTCAGATGGTAGAGTGCTGCGTTCGGGACGCAGAGGTCGTGGGTTCGAGT |
Downstream region at tRNA end position |
aggaggtgat |
Secondary structure (Cloverleaf model) | >SRA1039873 Pro CGG t ACag aggaggtgat C - G G - C G - C G - C G - C T - A G - C T G T C G C C C A A G A G | + | | | G T C T C G G T G G G C G | | | + T T G G A G T T A G AGGTC C - G T - A G - C C - G G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |