Sequence ID | >SRA1039878 |
Genome ID | SRR035090.590154 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001811) |
Species | |
Start position on genome | 502 |
End posion on genome | 429 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
nnnnnnnnnn |
tRNA gene sequence |
CGGGGTGTGGCGCAGTTGGTAGCGTGCTTGACTGGGGGTCAAGAGGTCGCAAGTTCAAGT |
Downstream region at tRNA end position |
gataatcaag |
Secondary structure (Cloverleaf model) | >SRA1039878 Pro GGG n ACtt gataatcaag C - G G - C G - C G + T G - C T - A G - C T G T T G T T C A T G A G + | | | | A T C G C G G C A A G C G | | | + T T G G C G T T A G AGGTC C - G T - A T - A G - C A - T C G T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |