Sequence ID | >SRA1039960 |
Genome ID | SRR035090.614748 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001811) |
Species | |
Start position on genome | 48 |
End posion on genome | 124 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
acgcgattta |
tRNA gene sequence |
GGGCGCTTAGCTCAGCTGGCTAGAGCATCTCGCTTACACCGAGGAGGCCGAGGGTTCGAG |
Downstream region at tRNA end position |
ttaggacaaa |
Secondary structure (Cloverleaf model) | >SRA1039960 Val TAC a ACCA ttaggacaaa G - C G - C G - C C - G G - C C - G T - A T G T C C C C C A C G A A | | | | G T C T C G G A G G G C G | | | | T T G G A G C C T A A AGGCC T + G C - G T - A C - G G - C C C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |