Sequence ID | >SRA1040010 |
Genome ID | SRR035091.16511 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001812) |
Species | |
Start position on genome | 305 |
End posion on genome | 233 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
cggatacatt |
tRNA gene sequence |
GCCCCTTTAGCTTAACGGATAAAGCACAAGCCTCCGGAGCTTGGGATGGAAGTTCGATTC |
Downstream region at tRNA end position |
aaaaataagt |
Secondary structure (Cloverleaf model) | >SRA1040010 Arg CCG t CAtt aaaaataagt G G C - G C - G C - G C - G T - A T - A T T T C C T T C A C A A A | | | | | G G T T C G G G A A G C G | | | | T T A A A G C T A A GGAT C - G A - T A - T G - C C - G C A T G C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |