Sequence ID | >SRA1040021 |
Genome ID | SRR035091.19995 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001812) |
Species | |
Start position on genome | 137 |
End posion on genome | 63 |
Amino Acid | Arg |
Anticodon | GCG |
Upstream region at tRNA start position |
tagttatttt |
tRNA gene sequence |
GCGCTCGTAGCTCAGTTGGATAGAGCGTCGGCTTGCGGAGCCGAAGGTCGTAGGTTCGAA |
Downstream region at tRNA end position |
ttgatatttt |
Secondary structure (Cloverleaf model) | >SRA1040021 Arg GCG t GCtt ttgatatttt G - C C - G G - C C - G T + G C - G G - C T A T C G T C C A T G A A | + | | | G T C T C G G T A G G C G | | | | T T G G A G C A T A G AGGTC T - A C - G G - C G - C C - G T A T G G C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |