Sequence ID | >SRA1040495 |
Genome ID | SRR035091.105780 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001812) |
Species | |
Start position on genome | 395 |
End posion on genome | 321 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
gcataaacat |
tRNA gene sequence |
TCCCTTGTGGCTTAATGGTAAAGCAGCAAACTGTTAATTTGTGTATTATTGGTTCGAGTC |
Downstream region at tRNA end position |
agaggaaagt |
Secondary structure (Cloverleaf model) | >SRA1040495 Asn GTT t GCTA agaggaaagt T - A C - G C - G C - G T + G T T G - C T G T T G A C C A A A G | + | | | G T T T C G A T T G G C G | | | | T T G A A G C T A A GTATT G + T C - G A - T A - T A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |