Sequence ID | >SRA1040534 |
Genome ID | SRR035091.110747 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001812) |
Species | |
Start position on genome | 231 |
End posion on genome | 304 |
Amino Acid | Ile |
Anticodon | TAT |
Upstream region at tRNA start position |
tcggtgtttT |
tRNA gene sequence |
GCATGCATAGCCAAACGGTAAGGCACTGCTCTTATATAGCAGCGAGTGAGAGTTCGATTC |
Downstream region at tRNA end position |
gatgattggc |
Secondary structure (Cloverleaf model) | >SRA1040534 Ile TAT T ATtg gatgattggc G - C C - G A - T T - A G - C C - G A - T T T T C T C T C A A A A | | | | | G C A C C G G A G A G C G | | | T T G A G G C T A A CGAGT C - G T - A G - C C - G T - A C T T A T A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |