Sequence ID | >SRA1040582 |
Genome ID | SRR035091.118618 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001812) |
Species | |
Start position on genome | 57 |
End posion on genome | 133 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
atttttaagg |
tRNA gene sequence |
TTGGCTATAGCTTAATTGGTTAAAGCATCGCCCTGTGAAGGCGAGGACTGTGGGTTCAAG |
Downstream region at tRNA end position |
atgtgaattg |
Secondary structure (Cloverleaf model) | >SRA1040582 His GTG g CCCA atgtgaattg T C T - A G - C G - C C - G T - A A - T T G T T A C C C A T A A A + | | | | A T T T C G G T G G G C G | | | | T T G A A G C T T A A GGACT T - A C - G G - C C - G C - G C A T A G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |