Sequence ID | >SRA1040588 |
Genome ID | SRR035091.119326 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001812) |
Species | |
Start position on genome | 262 |
End posion on genome | 338 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
taaggaggct |
tRNA gene sequence |
GGCCGGATGGCGAAGTTGGCTAACGCGGTGGTCTGCAAAACCATTATGCGCGGGTTCGAG |
Downstream region at tRNA end position |
gttttgttta |
Secondary structure (Cloverleaf model) | >SRA1040588 Cys GCA t TCAA gttttgttta G - C G - C C - G C - G G - C G - C A - T T G T C G C C C A T G A G | | | | | G T A G C G G C G G G C G | | | T T G A C G C C T A G TATGC G + T T - A G - C G - C T - A C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |