Sequence ID | >SRA1040759 |
Genome ID | SRR035091.144013 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001812) |
Species | |
Start position on genome | 317 |
End posion on genome | 391 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
aattttttat |
tRNA gene sequence |
GGCGGCGTAGCTCAATCGGTTAGAGCGCGGGACTCATAAGCCCGAGGTTACAGGTTCGAT |
Downstream region at tRNA end position |
aaacttaata |
Secondary structure (Cloverleaf model) | >SRA1040759 Met CAT t ACtg aaacttaata G + T G - C C - G G - C G - C C - G G - C T T T T G T C C A T A A A | | | | | G C C T C G A C A G G C G | | | | T T G G A G C T T A G AGGTT C - G G - C G - C G - C A G C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |