Sequence ID | >SRA1040906 |
Genome ID | SRR035091.167509 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001812) |
Species | |
Start position on genome | 236 |
End posion on genome | 320 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
taattaagat |
tRNA gene sequence |
GCCGAAGTGGTGGAACTGGTAGACACGCTGTGTTGAGGGCGCAGTGGGGAAACTCGTGCC |
Downstream region at tRNA end position |
taattgacaa |
Secondary structure (Cloverleaf model) | >SRA1040906 Leu GAG t ACCA taattgacaa G - C C - G C - G G - C A - T A - T G - C T T T C G G C C A C A A G | | | | | G T G G T G G C C G G C G | | | T T G A C A C T A G G TGGGGAAACTCGT C - G T - A G - C T + G G - C T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |