Sequence ID | >SRA1040987 |
Genome ID | SRR035091.178687 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001812) |
Species | |
Start position on genome | 312 |
End posion on genome | 385 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
gagttgccca |
tRNA gene sequence |
GCGGTGGTAGTTCAGTTGGTAGAACGTCTGCTTCCCAAGCAGAAGGTCGAGGGTTCAAAT |
Downstream region at tRNA end position |
tttaaagaaa |
Secondary structure (Cloverleaf model) | >SRA1040987 Gly CCC a TCat tttaaagaaa G - C C - G G - C G - C T - A G - C G - C T A T T T C C C A T G A A + | | | | A T C T T G G A G G G C G | | | | T T G G A A C T A G AGGTC T - A C - G T - A G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |