Sequence ID | >SRA1041039 |
Genome ID | SRR035091.186133 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001812) |
Species | |
Start position on genome | 152 |
End posion on genome | 226 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
caaaataaaa |
tRNA gene sequence |
GCCCCCGTAGTTAAACGGATATAACAAGCGCCTCCTAAGCGCTAGTTCCAAGTTCGATTC |
Downstream region at tRNA end position |
aaaaaactta |
Secondary structure (Cloverleaf model) | >SRA1041039 Arg CCT a ACAA aaaaaactta G - C C - G C - G C - G C - G C - G G - C T T T G G T T C A C A A A | | | | | G G A T T G C C A A G C G | | | | T T A T A A C T A A AGTT A - T G - C C - G G - C C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |