Sequence ID | >SRA1041186 |
Genome ID | SRR035091.210720 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001812) |
Species | |
Start position on genome | 270 |
End posion on genome | 196 |
Amino Acid | Arg |
Anticodon | TCG |
Upstream region at tRNA start position |
tagggatctt |
tRNA gene sequence |
ACGCCAGTAGCTCAGTGGATCAGAGCACTCCGCTTCGGACGGAGGGGTCGGGGGTTCGAA |
Downstream region at tRNA end position |
aaaaagaaaa |
Secondary structure (Cloverleaf model) | >SRA1041186 Arg TCG t ACtt aaaaagaaaa A - T C - G G - C C - G C - G A - T G - C T A T C T C C C A T G A A | + | | | G G C T C G G G G G G C G | | | | T T A G A G C T C A A GGGTC C - G T - A C - G C - G G - C C A T G T C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |