Sequence ID | >SRA1041187 |
Genome ID | SRR035091.210873 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001812) |
Species | |
Start position on genome | 106 |
End posion on genome | 32 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
cattaatcag |
tRNA gene sequence |
GGCCCCATCGTCTAGCGGTTAGGACATTGCCCTCTCACGGCGAAAACACCGGTTCGATTC |
Downstream region at tRNA end position |
tacgcgacac |
Secondary structure (Cloverleaf model) | >SRA1041187 Glu CTC g ACCA tacgcgacac G - C G + T C - G C - G C - G C - G A - T T T T T G G C C A C G A C | | | | | G G T C T G A C C G G C G + | | | T T T G G A C T A A AAAC T - A T + G G - C C - G C - G C C T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |