Sequence ID | >SRA1041224 |
Genome ID | SRR035091.216116 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001812) |
Species | |
Start position on genome | 228 |
End posion on genome | 152 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
acactattta |
tRNA gene sequence |
GGGTCCTTAGCTCAGTTGGTTAGAGCGCCAGCCTTTTAAGCTGGGCGTCCTGGGTTCAAA |
Downstream region at tRNA end position |
tgcgggtatc |
Secondary structure (Cloverleaf model) | >SRA1041224 Lys TTT a ACCA tgcgggtatc G - C G - C G - C T - A C - G C - G T - A T A T G A C C C A T G A A | | | | | A T C T C G C T G G G C G | | | | T T G G A G C T T A G GCGTC C - G C - G A - T G - C C - G C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |