Sequence ID | >SRA1041357 |
Genome ID | SRR035091.232266 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001812) |
Species | |
Start position on genome | 363 |
End posion on genome | 292 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
aggatgtgaa |
tRNA gene sequence |
GGGGTCCTAGCTCAGCGGGAGAGCACATGACTGAAGATCATGGTGTCCCGGGTTCGACTC |
Downstream region at tRNA end position |
aataaattgt |
Secondary structure (Cloverleaf model) | >SRA1041357 Phe GAA a Attt aataaattgt G - C G - C G - C G - C T - A C - G C - G T C T G G C C C A G A A | | | | | G C C T C G C C G G G C G | | | | T T G G A G C G A A GTGTC C - G A - T T - A G - C A - T C A T G G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |