Sequence ID | >SRA1041412 |
Genome ID | SRR035091.238582 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001812) |
Species | |
Start position on genome | 376 |
End posion on genome | 449 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
tactcgtatg |
tRNA gene sequence |
GTGCCTATAGCTCAATGGTTAGAGCTCTAGTTTGTGGAACTAGCGACGAGGGTTCGACTC |
Downstream region at tRNA end position |
tcaatatata |
Secondary structure (Cloverleaf model) | >SRA1041412 His GTG g CCAa tcaatatata G - C T - A G - C C - G C - G T - A A - T T C T C T C C C A T A A A | | | | | G G C T C G G A G G G C G | | | | T T T G A G C T A T CGAC C - G T - A A - T G - C T - A T A T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |