Sequence ID | >SRA1041435 |
Genome ID | SRR035091.242009 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001812) |
Species | |
Start position on genome | 16 |
End posion on genome | 102 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
tgagaacaaa |
tRNA gene sequence |
GGGGATGTGCTGGAACTGGTAGACAGGGTAGTCTCAAACACTACTGGACGCAAGTCCGTG |
Downstream region at tRNA end position |
aaaattatat |
Secondary structure (Cloverleaf model) | >SRA1041435 Leu CAA a ACCA aaaattatat G - C G - C G - C G - C A - T T - A G - C T C T C T C C C A C A A G | | | | | G T G G T C G A G G G C G | | | T T G A C A G T A G G TGGACGCAAGTCCGT G - C T - A A - T G - C T - A C C T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |