Sequence ID | >SRA1041462 |
Genome ID | SRR035091.245008 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001812) |
Species | |
Start position on genome | 422 |
End posion on genome | 495 |
Amino Acid | Arg |
Anticodon | TCG |
Upstream region at tRNA start position |
aattgttaaT |
tRNA gene sequence |
GAGCTCGTAGTTTAACGGATAGAATACCAGGTTTCGGCCCTGGGGATGGGAGTTCGATTC |
Downstream region at tRNA end position |
aaatcatatg |
Secondary structure (Cloverleaf model) | >SRA1041462 Arg TCG T GTtt aaatcatatg G - C A - T G - C C - G T - A C - G G - C T T T C C T T C A C A A A | | + | | G G T T T G G G G A G C G + | | + T T A G A A T T A A GGAT C - G C - G A - T G - C G - C T C T G T C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |