Sequence ID | >SRA1041497 |
Genome ID | SRR035091.250551 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001812) |
Species | |
Start position on genome | 99 |
End posion on genome | 174 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
attattatat |
tRNA gene sequence |
GGCGTGGTGCCCAAGTTGGTCTAAGGGAGTGGTTTGCAAAACCATCATTCGCCGGTTCGA |
Downstream region at tRNA end position |
tgacaattga |
Secondary structure (Cloverleaf model) | >SRA1041497 Cys GCA t TCtt tgacaattga G - C G - C C - G G - C T - A G - C G - C T A T C A G C C A T T G A G | | | | G G A C C C G C C G G C G | | | T T T A G G G C T A A CATTC G + T T - A G - C G - C T - A T A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |