Sequence ID | >SRA1041583 |
Genome ID | SRR035091.264660 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001812) |
Species | |
Start position on genome | 191 |
End posion on genome | 267 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
tagtttacgt |
tRNA gene sequence |
GGGCTCATAGCTCAGTTGGTTAGAGTACTTGCATGACATGCAAGGTGTCCGAGGTTCGAG |
Downstream region at tRNA end position |
tttacataag |
Secondary structure (Cloverleaf model) | >SRA1041583 Val GAC t ACCA tttacataag G - C G - C G - C C - G T + G C - G A - T T G T G C T C C A T G A A | | | | | G T C T C G C G A G G C G | | | + T T G G A G T T T A A GTGTC C - G T - A T - A G - C C - G A T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |