Sequence ID | >SRA1041587 |
Genome ID | SRR035091.265834 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001812) |
Species | |
Start position on genome | 331 |
End posion on genome | 260 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
ttgtaattat |
tRNA gene sequence |
GCCAGTATAGCTCAATGGTAGAGCTTCTCTCTTGTAAAGAGAATGTTGAGGGTTCAAGTC |
Downstream region at tRNA end position |
atgactaaag |
Secondary structure (Cloverleaf model) | >SRA1041587 Thr TGT t Ttac atgactaaag G - C C - G C - G A - T G - C T + G A - T T G T C T T C C A A A A | | + | | A T C T C G G A G G G C G | | | | T T G G A G C T A T ATGTT T - A C - G T - A C - G T - A C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |