Sequence ID | >SRA1041612 |
Genome ID | SRR035091.269923 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001812) |
Species | |
Start position on genome | 262 |
End posion on genome | 186 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
cagacgatat |
tRNA gene sequence |
TGACCCTTAGCACAGTTGGTCAGTGCAGCTCGCTCATAACGAGAAGGTCATAGGTTCAAT |
Downstream region at tRNA end position |
catggtctat |
Secondary structure (Cloverleaf model) | >SRA1041612 Met CAT t ACTA catggtctat T - A G - C A - T C - G C - G C - G T - A T T T T A T C C A T G A A | | | | | A T C A C G A T A G G C G | | | | T T G G T G C T C A A AGGTC G A C - G T - A C - G G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |