Sequence ID | >SRA1041677 |
Genome ID | SRR035091.277542 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001812) |
Species | |
Start position on genome | 322 |
End posion on genome | 236 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
agatgtttcc |
tRNA gene sequence |
GCCGGGATGGTGAAACTGGCAGACACGCTAGCTTGAGGGGCTAGTGGGAGAAATCCTGTG |
Downstream region at tRNA end position |
ctcaaatttt |
Secondary structure (Cloverleaf model) | >SRA1041677 Leu GAG c ACTA ctcaaatttt G - C C - G C - G G - C G - C G - C A - T T A T N G C T C A C A A G | | | | A T A G T G G C G A G C G | | | T T G A C A C C A G G TGGGAGAAATCCTGT C - G T - A A - T G - C C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |