Sequence ID | >SRA1041703 |
Genome ID | SRR035091.280496 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001812) |
Species | |
Start position on genome | 128 |
End posion on genome | 200 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
ggcattttgT |
tRNA gene sequence |
GGGCCCATAGTATAGTGGTAAAACACCTCCGTGGCACGGAGGAGTCGGGAGTTCGACTCT |
Downstream region at tRNA end position |
tgggcacttg |
Secondary structure (Cloverleaf model) | >SRA1041703 Ala GGC T ATtt tgggcacttg G - C G - C G + T C - G C - G C - G A - T T C T C C C T C A G A A | | | | | G T T A T G G G G A G C G | | | T T G A A A C T A A AGTC C - G C - G T - A C - G C - G G C T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |