Sequence ID | >SRA1041852 |
Genome ID | SRR035091.304846 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001812) |
Species | |
Start position on genome | 130 |
End posion on genome | 57 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
attttaaaaa |
tRNA gene sequence |
GCCCCCATAACTCAACGGTAGAGTAGTGGCCTCTTAAGCCATTAATCCAGGTTCGAATCC |
Downstream region at tRNA end position |
actctttttt |
Secondary structure (Cloverleaf model) | >SRA1041852 Lys CTT a ACAA actctttttt G - C C - G C - G C - G C - G C - G A - T T A T G G T C C A A A A | | | | | G C C T C A C C A G G C G | | | | T T G G A G T T A A TAAT G + T T - A G - C G - C C - G C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |