Sequence ID | >SRA1041857 |
Genome ID | SRR035091.305488 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001812) |
Species | |
Start position on genome | 160 |
End posion on genome | 232 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
cacaaattaT |
tRNA gene sequence |
TGCGGGATGGTGTAATGGCAACATTAAAGGCTCATAACCTTTCGCTGGAAGTTCGACTCT |
Downstream region at tRNA end position |
agtcattatt |
Secondary structure (Cloverleaf model) | >SRA1041857 Met CAT T ATtc agtcattatt T T G - C C - G G - C G - C G - C A - T T C T C T T T C A A A G | + | | | G T T G T G G G A A G C G | | | + T T G A C A T C A T CGCT A - T A - T A - T G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |