Sequence ID | >SRA1041860 |
Genome ID | SRR035091.306276 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001812) |
Species | |
Start position on genome | 82 |
End posion on genome | 156 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
aaattactct |
tRNA gene sequence |
GGCCCCTTAGTTCAATGGATAGAATAATTCCGTCCTAAGGAAGAGATGTAGGTTCGATTC |
Downstream region at tRNA end position |
ttcgactccc |
Secondary structure (Cloverleaf model) | >SRA1041860 Arg CCT t ACCA ttcgactccc G - C G - C C - G C - G C - G C - G T - A T T T C A T C C A T A A A | | | | | G G C T T G G T A G G C G | | | + T T A G A A T T A A AGAT A G T - A T - A C - G C - G G A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |