Sequence ID | >SRA1041947 |
Genome ID | SRR035091.317659 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001812) |
Species | |
Start position on genome | 442 |
End posion on genome | 526 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
attaatataT |
tRNA gene sequence |
GCAGGTGTGCCGGAGTGGTCAAACGGGACAGACTCAAGATCTGTTGGCTTATGCCTACGC |
Downstream region at tRNA end position |
ttcctaactc |
Secondary structure (Cloverleaf model) | >SRA1041947 Leu CAA T ATtt ttcctaactc G - C C - G A - T G - C G - C T - A G - C C A T T G T C C A T G A G + | | | | G G G G C C G C A G G C G | | | T T T A C G G C A A G TGGCTTATGCCTAC A - T C - G A - T G - C A - T C A T G C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |