| Sequence ID | >SRA1042076 |
| Genome ID | SRR035091.335078 |
| Phylum/Class | 454 Sequencing (SRP001812) |
| Species | |
| Start position on genome | 156 |
| End posion on genome | 228 |
| Amino Acid | Arg |
| Anticodon | GCG |
| Upstream region at tRNA start position |
attgggcgat |
| tRNA gene sequence |
GCGCCCATAGTTTAATGGATAGAATGATAGTTTGCGGAACTATTGATCCAGGTTCGATTC |
| Downstream region at tRNA end position |
tttaacaggt |
| Secondary structure (Cloverleaf model) | >SRA1042076 Arg GCG
t ACtt tttaacaggt
G + T
C - G
G - C
C - G
C - G
C - G
A - T T T
T G G T C C A
T A A A | | | | | G
G T T T G C C A G G C
G + | | + T T
A G A A T
T A G TGAT
A - T
T - A
A - T
G - C
T - A
T A
T G
G C G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |