Sequence ID | >SRA1042111 |
Genome ID | SRR035091.339875 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001812) |
Species | |
Start position on genome | 518 |
End posion on genome | 443 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
attaatttgt |
tRNA gene sequence |
CGGGGCGTGGCCTAGAGGCTAAGGCGCCGCGTTTGGGACGCGGAGATCGCTGGTTCGAGT |
Downstream region at tRNA end position |
gaaaatcatg |
Secondary structure (Cloverleaf model) | >SRA1042111 Pro TGG t ACCA gaaaatcatg C - G G - C G - C G - C G - C C - G G - C T G T T G A C C A A G A G + | | | | G G T C C G G C T G G C G | | | | T T C A G G C T A G AGATC C - G C - G G - C C - G G - C T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |