Sequence ID | >SRA1042196 |
Genome ID | SRR035091.352397 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001812) |
Species | |
Start position on genome | 78 |
End posion on genome | 4 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
gcgcacattt |
tRNA gene sequence |
GGGCCGTTAGCTCAGTGGTAGAGCAGCTGCCTCTTAAGCAGTTTGTCGCAGGTTCGAATC |
Downstream region at tRNA end position |
aaannnnnnn |
Secondary structure (Cloverleaf model) | >SRA1042196 Lys CTT t ACTA aaannnnnnn G - C G + T G - C C - G C - G G - C T - A T A T C G T C C A G A A | | | | | G T C T C G G C A G G C G | | | | T T G G A G C T A A TTGTC G + T C - G T - A G - C C - G C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |