Sequence ID | >SRA1042389 |
Genome ID | SRR035091.380992 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001812) |
Species | |
Start position on genome | 437 |
End posion on genome | 362 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
tctcttgaat |
tRNA gene sequence |
GGACAGATAGCTCAGTTGGTAGAGCAATGGACTGAAAATCCATGTGTCGTGGGTTCGATT |
Downstream region at tRNA end position |
tggtataccg |
Secondary structure (Cloverleaf model) | >SRA1042389 Phe GAA t ACCA tggtataccg G - C G - C A - T C - G A - T G - C A - T T T T C T C C C A T G A A | | | | G T C T C G G T G G G C G | | | | T T G G A G C T A A GTGTC A - T T - A G - C G - C A - T C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |