Sequence ID | >SRA1043020 |
Genome ID | SRR035092.22765 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001813) |
Species | |
Start position on genome | 331 |
End posion on genome | 418 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
cttattaata |
tRNA gene sequence |
TCTAGGGTAGCCGAGTTGGAAGCAGGCGGCGGACTGTTAATCCGTTAGGGTTTATCCCTC |
Downstream region at tRNA end position |
ttactattaa |
Secondary structure (Cloverleaf model) | >SRA1043020 Asn GTT a Gttt ttactattaa T - A C - G T - A A - T G - C G - C G - C T A T T G A C C A T T G A A | | | | | G G G C C G A C T G G C G | | | T T A A G G C A G C G TAGGGTTTATCCCTCATC G + T C - G G - C G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |