Sequence ID | >SRA1043032 |
Genome ID | SRR035092.25917 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001813) |
Species | |
Start position on genome | 109 |
End posion on genome | 33 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
aaatgtatac |
tRNA gene sequence |
GGTCCGGTGGTGTAGTTGGCTAACACACGGCCCTGTCACGGCTGAGATCACGGGTTCGAG |
Downstream region at tRNA end position |
tcatcctacg |
Secondary structure (Cloverleaf model) | >SRA1043032 Asp GTC c GCCA tcatcctacg G - C G - C T - A C - G C - G G - C G - C T G T T G C C C A T G A G | | | | | G T T G T G A C G G G C G | | | | T T G A C A C C T A A AGATC C - G G + T G - C C - G C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |