Sequence ID | >SRA1043052 |
Genome ID | SRR035092.30458 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001813) |
Species | |
Start position on genome | 33 |
End posion on genome | 104 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
gcactgaaaa |
tRNA gene sequence |
GGACCTTTAGCTCAATGGTAGAGCAGCAAGCTCATAACCTGTGTTGTGTTGGTTCGAATC |
Downstream region at tRNA end position |
tattattatt |
Secondary structure (Cloverleaf model) | >SRA1043052 Met CAT a Atta tattattatt G - C G - C A - T C - G C - G T - A T - A T A T C T A C C A A A A | | | | G T C T C G G T T G G C G | | | | T T G G A G C T A A GTTGT G + T C - G A - T A C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |