Sequence ID | >SRA1043360 |
Genome ID | SRR035092.100469 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001813) |
Species | |
Start position on genome | 451 |
End posion on genome | 376 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
nngctttgtg |
tRNA gene sequence |
CCCCCTGTAGCTCAGAGGATAGAGCAGCGGTTTCCTAAACCGCGTGTCGGGCGTTCGAGT |
Downstream region at tRNA end position |
caaaatgtaa |
Secondary structure (Cloverleaf model) | >SRA1043360 Arg CCT g ACCA caaaatgtaa C T C - G C - G C - G C - G T - A G - C T G T C C C G C A A G A A | | | | | G G C T C G G G G C G C G | | | | T T A G A G C T A A GTGTC G - C C - G G - C G - C T - A T A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |